miRNA_V1 & targets


source: Identification of miRNAs and miRNA-mediated regulatory pathways in Carica papaya
download: papaya.miRNA_v1

Conserved miRNAs and their targets

Order Family Member Sequence (5′-3′) Length
1 miR156 a TGACAGAAGAGAGTGAGCAC 20
2 b TGACAGAAGAGAGTGAGCAC 20
3 c TGACAGAAGAGAGTGAGCAC 20
4 d TGACAGAAGAGAGTGAGCAC 20
5 e TGACAGAAGAGAGAGAGCAC 20
6 f TTGACAGAAGATAGAGAGCAC 21
7 g TTGACAGAAGATAGAGAGCAC 21
8 miR159 TTTGGATTGAAGGGAGCTCTA 21
9 miR160 a TGCCTGGCTCCCTGTATGCCA 21
10 b TGCCTGGCTCCCTGTATGCCA 21
11 c TGCCTGGCTCCCTGTATGCCA 21
12 d TGCCTGGCTCCCTGAATGCCA 21
13 miR162 TCGATAAACCTCTGCATCCAG 21
14 miR164 a TGGAGAAGCAGGGCACGTGCA 21
15 b TGGAGAAGCAGGGCACGTGCA 21
16 c TGGAGAAGCAGGGCACGTGCA 21
17 miR166 a TCGGACCAGGCTTCATTCCCG 21
18 b TCGGACCAGGCTTCATTCCCC 21
19 c TCGGACCAGGCTTCATTCCCC 21
20 d TCGGACCAGGCTTCATTCCCC 21
21 e TTGGACCAGGCTTCATTCCCC 21
22 miR167 a TGAAGCTGCCAGCATGATCTA 21
23 b TGAAGCTGCCAGCATGATCTA 21
24 c TGAAGCTGCCAGCATGATCTT 21
25 d TGAAGCTGCCAGCATGATCTGA 22
26 miR168 a TCGCTTGGTGCAGGTCGGGAA 21
27 b TCGCTTGGTGCAGGTCGGGAT 21
28 miR169 a TAGCCAAGGATGACTTGCCTG 21
29 b TAGCCAAGGATGACTTGCCTG 21
30 c TAGCCAAGAATGACTTGCCTG 21
31 d CAGCCAAGGATGACTTGCCGG 21
32 e CAGCCAAGGATGACTTGCCGG 21
33 f CAGCCAAGGATGACTTGCCGG 21
34 g CAGCCAAGGATGACTTGCCGG 21
35 h TAGCCAAGGATGACTTGCCGG 21
36 i GAGCCAAGGATGACTTGCCAG 21
37 k CAGCCAAGAATGACTTGCCG 20
38 miR171 a TGATTGAGCCGTGCCAATATC 21
39 b TGATTGAGCCGTGCCAATATC 21
40 c TGATTGAGCCGTGCCAATATC 21
41 d TGATTGAGCCGTGCCAATATC 21
42 e TGATTGAGCCGTGCCAATATC 21
43 miR172 a GGGAATCTTGATGATGCTGCA 21
44 b GGGAATCTTGATGATGCTGCA 21
45 c AGAATCTTGATGATGCTGCAT 21
46 miR319 a TATGAATGATGCGGGAGATAT 21
47 b TGTGAATGATGCGGGAGATAA 21
48 miR390 a AAGCTCAGGAGGGATAGCGCC 21
49 b AAGCTCAGGAGGGATAGCGCC 21
50 miR393 TCCAAAGGGATCGCATTGATC 21
51 miR394 a TTGGCATTCTGTCCACCTCC 20
52 b TTGGCATTCTGTCCACCTCC 20
53 miR395 a CTGAAGTGTTTGGGGGAACAC 21
54 b CTGAAGTGTTTGGGGGAACTC 21
55 c CTGAAGTGTTTGGGGGAACTC 21
56 d CTGAAGTGTTTGGGGGAACTC 21
57 e CTGAAGTGTTTGGGGGAACTC 21
58 f CTGAAGTGTTTGGGGGAACTC 21
59 miR396 a TTCCACAGCTTTCTTGAACTT 21
60 b TTCCACAGCTTTCTTGAACTG 21
61 c TTCCACAGCTTTCTTGAACTG 21
62 miR397 TCATTGAGTGCAGCGTTGATG 21
63 miR398 a TGTGTTCTCAGGTCGCCCCTG 21
64 b TGTGTTCTCAGGTCACCCCTT 21
65 miR399 a TGCCAAAGGAGATTTGCCCAG 21
66 b TGCCAAAGGAGATTTGCCCGG 21
67 c TGCCAAAGGAGATTTGCCCGG 21
68 d TGCCAAAGGAGAATTGCCCTG 21
69 e TGCCAAAGGAGAATTGCCCTG 21
70 f TGCCAAAGGAGAGTTGCCCTG 21
71 miR403 CTAGATTCACGCACAAACTCG 21
72 miR408 CTGCACTGCCTCTTCCCTGGC 21
73 miR530 TGCATTTGCACCTGCACCTTA 21
74 miR535 TGACAACGAGAGAGAGCACGC 21
75 miR3627 TTGTCGCAGGAGCGATGGCACC 22

Papaya-specific miRNAs and their targets

Order Family Sequence (5′-3′) Length
1 miR-c1 TCAATGACACAAGCTCGGAGCA 22
2 miR-c2 GGGGATGTAGCTCAGATGGT 20
3 miR-c3 GCCGGCCGGGGGACGGACTGGG 22
4 miR-c4 CTTTTCAAGACTTCAGCTTCA 21
5 miR-c5 AGACCTTGGGATGCGGATTACC 22
6 miR-c6 TTTTGCATGACTCAGGAGATGT 22
7 miR-c7 AAGGAATAGCAACTTCTGTCA 21
8 miR-c8 TACGCAGGAGAGATGGCGCCGT 22
9 miR-c9 CATTCTTCTTTGTGAGTCGGG 21
10 miR-c10 TCTGGTAGAGATTTGAGCATG 21
11 miR-c11 TAAAGTGGAATTGGGATAATA 21

miRNA_V2


source: miRBase
download:


OrderIDAccessionCited reference
1cpa-MIR162aMI0006308
2cpa-MIR8139eMI0026388PMID:23216749
3cpa-MIR395cMI0026371PMID:23216749
4cpa-MIR171cMI0026360PMID:23216749
5cpa-MIR8150MI0026399PMID:23216749
6cpa-MIR156cMI0026330PMID:23216749
7cpa-MIR8140MI0026389PMID:23216749
8cpa-MIR8148MI0026397PMID:23216749
9cpa-MIR156fMI0026333PMID:23216749
10cpa-MIR535MI0026376PMID:23216749
11cpa-MIR169MI0026357PMID:23216749
12cpa-MIR164bMI0026344PMID:23216749
13cpa-MIR172aMI0026362PMID:23216749
14cpa-MIR171bMI0026359PMID:23216749
15cpa-MIR171aMI0026358PMID:23216749
16cpa-MIR160fMI0026342PMID:23216749
17cpa-MIR396MI0026374PMID:23216749
18cpa-MIR166cMI0026350PMID:23216749
19cpa-MIR159aMI0026334PMID:23216749
20cpa-MIR166bMI0026349PMID:23216749
21cpa-MIR8146MI0026395PMID:23216749
22cpa-MIR8139aMI0026384PMID:23216749
23cpa-MIR8135MI0026379PMID:23216749
24cpa-MIR8136MI0026381PMID:23216749
25cpa-MIR398MI0026378PMID:23216749
26cpa-MIR171dMI0026361PMID:23216749
27cpa-MIR164dMI0026346PMID:23216749
28cpa-MIR8143MI0026392PMID:23216749
29cpa-MIR160bMI0026338PMID:23216749
30cpa-MIR8139bMI0026385PMID:23216749
31cpa-MIR160dMI0026340PMID:23216749
32cpa-MIR164cMI0026345PMID:23216749
33cpa-MIR156eMI0026332PMID:23216749
34cpa-MIR167cMI0026355PMID:23216749
35cpa-MIR160aMI0026337PMID:23216749
36cpa-MIR395aMI0026369PMID:23216749
37cpa-MIR8147MI0026396PMID:23216749
38cpa-MIR8137MI0026382PMID:23216749
39cpa-MIR8138MI0026383PMID:23216749
40cpa-MIR408MI0026375PMID:23216749
41cpa-MIR166dMI0026351PMID:23216749
42cpa-MIR160eMI0026341PMID:23216749
43cpa-MIR164aMI0026343PMID:23216749
44cpa-MIR160cMI0026339PMID:23216749
45cpa-MIR166aMI0026348PMID:23216749
46cpa-MIR167bMI0026354PMID:23216749
47cpa-MIR393MI0026366PMID:23216749
48cpa-MIR390bMI0026365PMID:23216749
49cpa-MIR8139cMI0026386PMID:23216749
50cpa-MIR8152MI0026401PMID:23216749
51cpa-MIR8145MI0026394PMID:23216749
52cpa-MIR164eMI0026347PMID:23216749
53cpa-MIR395eMI0026373PMID:23216749
54cpa-MIR8142MI0026391PMID:23216749
55cpa-MIR5211MI0026403PMID:23216749
56cpa-MIR159bMI0026335PMID:23216749
57cpa-MIR390aMI0026364PMID:23216749
58cpa-MIR172bMI0026363PMID:23216749
59cpa-MIR156aMI0026328PMID:23216749
60cpa-MIR319MI0026336PMID:23216749
61cpa-MIR8151MI0026400PMID:23216749
62cpa-MIR8134MI0026377PMID:23216749
63cpa-MIR156dMI0026331PMID:23216749
64cpa-MIR395bMI0026370PMID:23216749
65cpa-MIR8139dMI0026387PMID:23216749
66cpa-MIR8154MI0026404PMID:23216749
67cpa-MIR394aMI0026367PMID:23216749
68cpa-MIR477MI0026380PMID:23216749
69cpa-MIR167dMI0026356PMID:23216749
70cpa-MIR8141MI0026390PMID:23216749
71cpa-MIR8153MI0026402PMID:23216749
72cpa-MIR167aMI0026353PMID:23216749
73cpa-MIR166eMI0026352PMID:23216749
74cpa-MIR8155MI0026405PMID:23216749
75cpa-MIR8149MI0026398PMID:23216749
76cpa-MIR8144MI0026393PMID:23216749
77cpa-MIR156bMI0026329PMID:23216749
78cpa-MIR394bMI0026368PMID:23216749
79cpa-MIR395dMI0026372PMID:23216749

miRNA_V3


source: PmiREN
download:
Order ID Sequence
1 Cpa-miR156a TGACAGAAGAGAGTGAGCAC
2 Cpa-miR156b TGACAGAAGAGAGTGAGCAC
3 Cpa-miR156c TGACAGAAGAGAGTGAGCAC
4 Cpa-miR156d TGACAGAAGAGAGTGAGCAC
5 Cpa-miR156e TTGACAGAAGAGAGAGAGCAC
6 Cpa-miR157a TTGACAGAAGATAGAGAGCAC
7 Cpa-miR157b TTGACAGAAGATAGAGAGCAC
8 Cpa-miR159a AGGATTTTGCAGGGTTGATTG
9 Cpa-miR159b AGCTGCCGACTCATTCATTCA
10 Cpa-miR160a TGCCTGGCTCCCTGTATGCCA
11 Cpa-miR160b TGCCTGGCTCCCTGTATGCCA
12 Cpa-miR160c TGCCTGGCTCCCTGTATGCCA
13 Cpa-miR160d TGCCTGGCTCCCTGAATGCCA
14 Cpa-miR162 TCGATAAACCTCTGCATCCAG
15 Cpa-miR164a TGGAGAAGCAGGGCACGTGCA
16 Cpa-miR164b TGGAGAAGCAGGGCACGTGCA
17 Cpa-miR164c TGGAGAAGCAGGGCACGTGCA
18 Cpa-miR166a TCGGACCAGGCTTCATTCCCC
19 Cpa-miR166b TCGGACCAGGCTTCATTCCCC
20 Cpa-miR166c TCGGACCAGGCTTCATTCCCC
21 Cpa-miR166d TCGGACCAGGCTTCATTCCCG
22 Cpa-miR166e TCGGACCAGGCTTCATTCCCC
23 Cpa-miR166f TTGGACCAGGCTTCATTCCCC
24 Cpa-miR167a TGAAGCTGCCAGCATGATCTA
25 Cpa-miR167b TGAAGCTGCCAGCATGATCTA
26 Cpa-miR167c TGAAGCTGCCAGCATGATCTT
27 Cpa-miR167d TGAAGCTGCCAGCATGATCTGA
28 Cpa-miR169a CAGCCAAGAATGACTTGCCGA
29 Cpa-miR169b CAGCCAAGGATGACTTGCCGG
30 Cpa-miR169c TAGCCAAGGATGACTTGCCTG
31 Cpa-miR169d CAGCCAAGGATGACTTGCCGG
32 Cpa-miR169e CAGCCAAGGATGACTTGCCGG
33 Cpa-miR169f CAGCCAAGGATGACTTGCCGG
34 Cpa-miR169g TAGCCAAGGATGACTTGCCTG
35 Cpa-miR170 AGCCGCGTCAATATCTCCTTC
36 Cpa-miR171a TGATTGAGCCGTGCCAATATC
37 Cpa-miR171b TGATTGAGCCGTGCCAATATC
38 Cpa-miR171c TGATTGAGCCGTGCCAATATC
39 Cpa-miR171d TGATTGAGCCGTGCCAATATC
40 Cpa-miR171e TGATTGAGCCGTGCCAATATC
41 Cpa-miR172a TGGGAATCTTGATGATGCTGC
42 Cpa-miR172b TGGGAATCTTGATGATGCTGC
43 Cpa-miR172c AGAATCTTGATGATGCTGCAT
44 Cpa-miR390a AAGCTCAGGAGGGATAGCGCC
45 Cpa-miR390b AAGCTCAGGAGGGATAGCGCC
46 Cpa-miR391 TACGCAGGAGAGATGGCGCCGT
47 Cpa-miR393 TCCAAAGGGATCGCATTGATC
48 Cpa-miR394a TTGGCATTCTGTCCACCTCC
49 Cpa-miR394b ATTGGCATTCTGTCCACCTCC
50 Cpa-miR395a CTGAAGTGTTTGGGGGAACTC